Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17269887

Xenopus ORFeome
What is the ORFeome?

ORF Name:clip3.S ORF1 Species: laevis
Gene Symbol: clip3.S Entrez Gene ID: 495693
Gene Synonyms: clipr-59, clipr59, rsnl1
Gene Name: CAP-Gly domain containing linker protein 3
Description: Cytoskeleton-associated protein and related proteins
Plate: GDExl11074 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835778
3' ORF Sequence: JZ835779
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495693, mRNA (cDNA clone MGC:83974 IMAGE:6945306), complete cds
Template Accession: BC086287
GI: 55250668
Clone ID: IMAGE:6945306
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAGAGAGGACCTCCCTGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTTCATCTCAGCACGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556