Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17270055

Xenopus ORFeome
What is the ORFeome?

ORF Name:cndp2.S ORF2 Species: laevis
Gene Symbol: cndp2.S Entrez Gene ID: 380001
Gene Synonyms: cn2, cpgl, darmin-r, darmin-related
Gene Name: CNDP dipeptidase 2 (metallopeptidase M20 family)
Description: metallopeptidase
Plate: GDExl11088 Well: G05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ838125
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cytosolic nonspecific dipeptidase, mRNA (cDNA clone MGC:154286 IMAGE:8072366), complete cds
Template Accession: BC123115
GI: 116063512
Clone ID: IMAGE:8072366
Tissue: fat body
Stage:
Clone Library: NICHD_XGC_FaB
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGTTCTGCCAGCCCTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCAGGTTGGATACTTCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers