Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17270061

Xenopus ORFeome
What is the ORFeome?

ORF Name:cndp2.L ORF1 Species: laevis
Gene Symbol: cndp2.L Entrez Gene ID: 446978
Gene Synonyms: cn2, cpgl, darmin-r, darmin-related
Gene Name: CNDP dipeptidase 2 (metallopeptidase M20 family)
Description: metallopeptidase
Plate: GDExl11051 Well: C03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831590
3' ORF Sequence: JZ831591
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis CNDP dipeptidase 2 (metallopeptidase M20 family), mRNA (cDNA clone MGC:82085 IMAGE:7011654), complete cds
Template Accession: BC075171
GI: 49670416
Clone ID: IMAGE:7011654
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGTTCTGCCAGTCCTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCAGGTTGGACACTTCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers