Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17270247

Xenopus ORFeome
What is the ORFeome?

ORF Name:col1a1.S ORF1 Species: laevis
Gene Symbol: col1a1.S Entrez Gene ID: 380515
Gene Synonyms:
Gene Name: collagen, type I, alpha 1
Description:
Plate: GDExl11016 Well: F12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824338
3' ORF Sequence: JZ829697
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis collagen, type I, alpha 1, mRNA (cDNA clone MGC:52532 IMAGE:5572094), complete cds
Template Accession: BC049829
GI: 29436388
Clone ID: IMAGE:5572094
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCAGCTTTGTGGATACACGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGAAGCAGACTGGTCCGAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556