Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17270385

Xenopus ORFeome
What is the ORFeome?

ORF Name:copa.L ORF1 Species: laevis
Gene Symbol: copa.L Entrez Gene ID: 446322
Gene Synonyms:
Gene Name: COPI coat complex subunit alpha
Description: Vesicle coat complex COPI, alpha subunit
Plate: GDExl11059 Well: D06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833067
3' ORF Sequence: JZ833068
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis coatomer protein complex, subunit alpha, mRNA (cDNA clone MGC:84477 IMAGE:7020631), complete cds
Template Accession: BC075251
GI: 49670464
Clone ID: IMAGE:7020631
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGACGAAGTTCGAGACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGGAACTGCAGAGGACTGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers