Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17270889

Xenopus ORFeome
What is the ORFeome?

ORF Name:crybb1.L ORF1 Species: laevis
Gene Symbol: crybb1.L Entrez Gene ID: 373744
Gene Synonyms: beta-crystallin-b1, catcn3
Gene Name: crystallin beta B1
Description:
Plate: GDExl11078 Well: B05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836379
3' ORF Sequence: JZ836380
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:115166 IMAGE:6955627, complete cds
Template Accession: BC094269
GI: 62948122
Clone ID: IMAGE:6955627
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCACACATCCAAAGCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGGTTGCTGCAATAACGAAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556