Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271189

Xenopus ORFeome
What is the ORFeome?

ORF Name:ctnnb1.L ORF1 Species: laevis
Gene Symbol: ctnnb1.L Entrez Gene ID: 399274
Gene Synonyms: b-catenin, beta catenin, beta-catenin, ctnnb1-a, ctnnb1-b, β-catenin
Gene Name: catenin beta 1
Description: adherens junction protein/component of wnt signaling pathway
Plate: GDExl11047 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831048
3' ORF Sequence: JZ831049
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis beta-catenin protein, mRNA (cDNA clone MGC:79992 IMAGE:6865915), complete cds
Template Accession: BC082826
GI: 52354602
Clone ID: IMAGE:6865915
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACTCAAGCAGATCTAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGTCAGTGTCAAACCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers