Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271201

Xenopus ORFeome
What is the ORFeome?

ORF Name:ctnnb1.S ORF2 Species: laevis
Gene Symbol: ctnnb1.S Entrez Gene ID: 380441
Gene Synonyms: b-catenin, beta catenin, beta-catenin, ctnnb1-a, ctnnb1-b, β-catenin
Gene Name: catenin beta 1
Description: adherens junction protein/component of wnt signaling pathway
Plate: GDExl11088 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis catenin, mRNA (cDNA clone MGC:154290 IMAGE:8071429), complete cds
Template Accession: BC128668
GI: 118764076
Clone ID: IMAGE:8071429
Tissue: fat body
Stage:
Clone Library: NICHD_XGC_FaB
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACTCAAGATCTAATGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAGTCAGTGTCAAACCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers