Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271243

Xenopus ORFeome
What is the ORFeome?

ORF Name:ctrb1.L ORF1 Species: laevis
Gene Symbol: ctrb1.L Entrez Gene ID: 379607
Gene Synonyms: chymotrypsinogen b, ctrb
Gene Name: chymotrypsinogen B1
Description: Trypsin
Plate: GDExl11002 Well: F08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839281
3' ORF Sequence: JZ839280
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Chymotrypsinogen 2, mRNA (cDNA clone MGC:64417 IMAGE:6879524), complete cds
Template Accession: BC056849
GI: 34784895
Clone ID: IMAGE:6879524
Tissue: whole organism
Stage: NF stage 54 to prometamorphosis stage
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCCTTTGGCTTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGGAGGCAACAATCTCGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers