Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271285

Xenopus ORFeome
What is the ORFeome?

ORF Name:ctsh.L ORF1 Species: laevis
Gene Symbol: ctsh.L Entrez Gene ID: 100036949
Gene Synonyms: loc496748
Gene Name: cathepsin H
Description: Cysteine proteinase Cathepsin L
Plate: GDExl11091 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838616
3' ORF Sequence: JZ838615
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100036949, mRNA (cDNA clone MGC:160390 IMAGE:8546791), complete cds
Template Accession: BC129703
GI: 120538298
Clone ID: IMAGE:8546791
Tissue: thymus
Stage:
Clone Library: NICHD_XGC_thy
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAGTGCTTCGGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTTCAACTCCATAGAAGCTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.0


Major funding for Xenbase is provided by grant P41 HD064556