Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271747

Xenopus ORFeome

ORF Name:dact1 ORF1 Species: laevis
Gene Symbol: dact1.S Entrez Gene ID: 398315
Gene Synonyms: dact1-a, dact1-b, dapper, dapper 1, dapper1, dpr, dpr1, frodo, hdpr1, thyex3, xdpr
Gene Name: dishevelled-binding antagonist of beta-catenin 1
Description: antagonist of beta-catenin and c-jun N-terminal kinase signaling
Plate: GDExl11035 Well: E03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ826872
3' ORF Sequence: JZ826871
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Frodo, mRNA (cDNA clone MGC:80250 IMAGE:5049021), complete cds
Template Accession: BC072855
GI: 49115008
Clone ID: MGC:80250 IMAGE:5049021
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCCCATTCCCTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTGTTGTCATCAGCTTTAAAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556