Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271777

Xenopus ORFeome

ORF Name:dand5 ORF1 Species: laevis
Gene Symbol: dand5.S Entrez Gene ID: 594864
Gene Synonyms: 51-b6, cer2, cerl2, cktsf1b3, coco, crl2, dante, grem3, s10-51-b6, xcoco
Gene Name: DAN domain family member 5, BMP antagonist
Description: maternal BMP/TGFbeta/Wnt inhibitor
Plate: GDExl11081 Well: E07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ837057
3' ORF Sequence: JZ837056
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Coco, mRNA (cDNA clone MGC:115676 IMAGE:6324534), complete cds
Template Accession: BC099052
GI: 68533787
Clone ID: MGC:115676 IMAGE:6324534
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTTGTTCCAGGCCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAAACGGGCAGGTAGTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556