Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271807

Xenopus ORFeome
What is the ORFeome?

ORF Name:dapk2.L ORF1 Species: laevis
Gene Symbol: dapk2.L Entrez Gene ID: 496293
Gene Synonyms: drp-1, drp1
Gene Name: death-associated protein kinase 2
Description: Ca2+/calmodulin-dependent protein kinase, EF-Hand protein superfamily
Plate: GDExl11070 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835133
3' ORF Sequence: JZ835134
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496293, mRNA (cDNA clone MGC:98827 IMAGE:3401390), complete cds
Template Accession: BC088802
GI: 57032741
Clone ID: IMAGE:3401390
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCATTTAAGCACGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAACAGCTGCTCAAGCGCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.2


Major funding for Xenbase is provided by grant P41 HD064556