Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17271813

Xenopus ORFeome
What is the ORFeome?

ORF Name:dapk3.L ORF1 Species: laevis
Gene Symbol: dapk3.L Entrez Gene ID: 734514
Gene Synonyms:
Gene Name: death-associated protein kinase 3
Description: Ca2+/calmodulin-dependent protein kinase, EF-Hand protein superfamily
Plate: GDExl11073 Well: H02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ835360
3' ORF Sequence: JZ835361
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC114871, mRNA (cDNA clone MGC:114871 IMAGE:5506395), complete cds
Template Accession: BC097619
GI: 66911520
Clone ID: IMAGE:5506395
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGGATTCCGGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACACTCCTCTTAATCCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.2


Major funding for Xenbase is provided by grant P41 HD064556