Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17272491

Xenopus ORFeome
What is the ORFeome?

ORF Name:dhrs13.L ORF1 Species: laevis
Gene Symbol: dhrs13.L Entrez Gene ID: 494661
Gene Synonyms:
Gene Name: dehydrogenase/reductase (SDR family) member 13
Description: Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases)
Plate: GDExl11042 Well: D08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828158
3' ORF Sequence: JZ828157
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC494661, mRNA (cDNA clone MGC:80965 IMAGE:5536468), complete cds
Template Accession: BC082634
GI: 52138906
Clone ID: IMAGE:5536468
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTACCAGTGATTCTGCTGCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGGCCAATCCGGTCATCCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556