Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17272623

Xenopus ORFeome
What is the ORFeome?

ORF Name:dlc.L ORF1 Species: laevis
Gene Symbol: dlc.L Entrez Gene ID: 379238
Gene Synonyms: delta-2, delta2, dll3, x-delta-2, x-delta2
Gene Name: putative ortholog of delta-like protein C precursor (SwissPro)
Description: Fibrillins and related proteins containing Ca2+-binding EGF-like domains
Plate: GDExl11015 Well: C02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824212
3' ORF Sequence: JZ829521
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to delta-like 1 (Drosophila), mRNA (cDNA clone MGC:52561 IMAGE:5570232), complete cds
Template Accession: BC044262
GI: 28278679
Clone ID: IMAGE:5570232
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCACCCCTGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACCTCAGTGGCAAATATACAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556