Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273325

Xenopus ORFeome
What is the ORFeome?

ORF Name:dvl2.L ORF1 Species: laevis
Gene Symbol: dvl2.L Entrez Gene ID: 399301
Gene Synonyms: dishevelled, dsh, dvl, xdsh
Gene Name: dishevelled segment polarity protein 2
Description: wnt signal transduction
Plate: GDExl11081 Well: D03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ836904
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis dishevelled homolog, mRNA (cDNA clone MGC:85126 IMAGE:6868624), complete cds
Template Accession: BC090218
GI: 58701966
Clone ID: IMAGE:6868624
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGACTAAAGTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGATTGTAGGAGAGAGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556