Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273439

Xenopus ORFeome

ORF Name:e2f3 ORF1 Species: laevis
Gene Symbol: e2f3.S Entrez Gene ID: 398159
Gene Synonyms:
Gene Name: E2F transcription factor 3
Description: transcription factor involved in control of cell cycle progression
Plate: GDExl11074 Well: A01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ835552
3' ORF Sequence: JZ835553
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor E2F, mRNA (cDNA clone MGC:114595 IMAGE:6631438), complete cds
Template Accession: BC097504
GI: 66910670
Clone ID: MGC:114595 IMAGE:6631438
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAAAAGGATTCCAGGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGCACATAAAGTCATCCAAAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556