Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273469

Xenopus ORFeome

ORF Name:eaf1 ORF1 Species: laevis
Gene Symbol: eaf1.L Entrez Gene ID: 444379
Gene Synonyms:
Gene Name: ELL associated factor 1
Description: protein associated with transcriptional elongation factor
Plate: GDExl11041 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ827855
3' ORF Sequence: JZ827854
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC82880 protein, mRNA (cDNA clone MGC:82880 IMAGE:5512365), complete cds
Template Accession: BC073583
GI: 49118575
Clone ID: MGC:82880 IMAGE:5512365
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGGACTCCACCCCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTACACCACAGAACCTTTATGAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556