Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273475

Xenopus ORFeome
What is the ORFeome?

ORF Name:eaf2.L ORF1 Species: laevis
Gene Symbol: eaf2.L Entrez Gene ID: 398779
Gene Synonyms:
Gene Name: ELL associated factor 2
Description: protein associated with transcriptional elongation factor
Plate: GDExl11021 Well: C11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824812
3' ORF Sequence: JZ830183
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68453, mRNA (cDNA clone MGC:68453 IMAGE:3397343), complete cds
Template Accession: BC060327
GI: 37805178
Clone ID: IMAGE:3397343
Tissue: liver
Stage:
Clone Library: NICHD_XGC_Li1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGAGCAGCCTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCGTCACTGTCGCTCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556