Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273481

Xenopus ORFeome

ORF Name:eapp ORF1 Species: laevis
Gene Symbol: eapp.L Entrez Gene ID: 444108
Gene Synonyms:
Gene Name: E2F-associated phosphoprotein
Description: Uncharacterized conserved protein
Plate: GDExl11037 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ827199
3' ORF Sequence: JZ827198
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80433 protein, mRNA (cDNA clone MGC:80433 IMAGE:5155538), complete cds
Template Accession: BC073191
GI: 49118190
Clone ID: MGC:80433 IMAGE:5155538
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACGCGGCTACA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGTGGCTAGCAAGAACATTGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556