Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273565

Xenopus ORFeome
What is the ORFeome?

ORF Name:edar.L ORF1 Species: laevis
Gene Symbol: edar.L Entrez Gene ID: 380208
Gene Synonyms:
Gene Name: ectodysplasin A receptor
Description:
Plate: GDExl11020 Well: D05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824597
3' ORF Sequence: JZ829948
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ectodysplasin 1, anhidrotic receptor, mRNA (cDNA clone MGC:69039 IMAGE:4964984), complete cds
Template Accession: BC056067
GI: 33416695
Clone ID: IMAGE:4964984
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCAACCAGGTGACAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAACTTTCATTTGTGGGTAAAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556