Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273625

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef1a-o1 ORF1 Species: laevis
Gene Symbol: Entrez Gene ID: 379289
Gene Synonyms:
Gene Name:
Description:
Plate: GDExl11013 Well: G02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824096
3' ORF Sequence: JZ829404
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis elongation factor 1 alpha, oocyte form, mRNA (cDNA clone MGC:53846 IMAGE:5542718), complete cds
Template Accession: BC045083
GI: 28280016
Clone ID: IMAGE:5542718
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGGAAAAGATTCACATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTGCCAGCTTTTGCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556