Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273637

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef1a1.S ORF1 Species: laevis
Gene Symbol: eef1a1.S Entrez Gene ID: 386604
Gene Synonyms: eef1a-s, ef-1 alpha, ef1alpha, elongation factor-1 alpha
Gene Name: eukaryotic translation elongation factor 1 alpha 1
Description: cytoplasmic protein required for protein synthesis
Plate: GDExl11015 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824219
3' ORF Sequence: JZ829528
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis eukaryotic translation elongation factor 1 alpha, somatic form, mRNA (cDNA clone MGC:53288 IMAGE:5570176), complete cds
Template Accession: BC043843
GI: 27882619
Clone ID: IMAGE:5570176
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAAGGAAAAGACTCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCGTTTTCGCGGCTTTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556