Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273649

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef1a2.S ORF1 Species: laevis
Gene Symbol: eef1a2.S Entrez Gene ID: 380550
Gene Synonyms: eef1al, ef-1-alpha-2, ef1a, stnl
Gene Name: eukaryotic translation elongation factor 1 alpha 2
Description: Translation elongation factor EF-1 alpha/Tu
Plate: GDExl11002 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839389
3' ORF Sequence: JZ839388
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis eukaryotic translation elongation factor 1 alpha 2, mRNA (cDNA clone MGC:64523 IMAGE:6877873), complete cds
Template Accession: BC054279
GI: 32484243
Clone ID: IMAGE:6877873
Tissue: whole organism
Stage: NF stage 53
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAAAGAGAAGACAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTGCAGCCTTCTGGGCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556