Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17273673

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef1g.L ORF1 Species: laevis
Gene Symbol: eef1g.L Entrez Gene ID: 379456
Gene Synonyms: eef1g-a, eef1g-b, ef1g, gig35
Gene Name: eukaryotic translation elongation factor 1 gamma
Description: Translation elongation factor EF-1 gamma
Plate: GDExl11001 Well: B02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839084
3' ORF Sequence: JZ839083
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis elongation factor 1 gamma, mRNA (cDNA clone MGC:64329 IMAGE:6876456), complete cds
Template Accession: BC054190
GI: 32484262
Clone ID: IMAGE:6876456
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGCGGGACTTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGAAGATCTTGCCCTGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers