Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274039

Xenopus ORFeome
What is the ORFeome?

ORF Name:eif4e3.L ORF1 Species: laevis
Gene Symbol: eif4e3.L Entrez Gene ID: 414635
Gene Synonyms: eif4e3-a, eif4e3-b
Gene Name: eukaryotic translation initiation factor 4E family member 3
Description: Predicted mRNA cap-binding protein related to eIF-4E
Plate: GDExl11028 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825514
3' ORF Sequence: JZ825513
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC81298, mRNA (cDNA clone MGC:81298 IMAGE:6632136), complete cds
Template Accession: BC068775
GI: 46249549
Clone ID: IMAGE:6632136
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTCCCCGTGGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTCTTGAGCGCCCCCCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers