Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274087

Xenopus ORFeome
What is the ORFeome?

ORF Name:elavl2.S ORF1 Species: laevis
Gene Symbol: elavl2.L Entrez Gene ID: 394342
Gene Synonyms: el-1, elavl2-a, elavl2-b, elrb, hel-n1, heln1, hub
Gene Name: ELAV like neuron-specific RNA binding protein 2
Description: RNA binding
Plate: GDExl11076 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836193
3' ORF Sequence: JZ836194
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B), mRNA (cDNA clone MGC:115020 IMAGE:6859777), complete cds
Template Accession: BC094189
GI: 62739310
Clone ID: IMAGE:6859777
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAACACAGCTATCCAATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCTTTGTGTGTTTTGCTCGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers