Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274099

Xenopus ORFeome
What is the ORFeome?

ORF Name:elavl4.L ORF2 Species: laevis
Gene Symbol: elavl4.L Entrez Gene ID: 386602
Gene Synonyms: elrd, elrd1, elrd2, hud
Gene Name: ELAV like neuron-specific RNA binding protein 4
Description: RNA binding
Plate: GDExl11020 Well: B05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824653
3' ORF Sequence: JZ830004
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis RNA-binding protein HuD, mRNA (cDNA clone MGC:68949 IMAGE:4959211), complete cds
Template Accession: BC056021
GI: 33585949
Clone ID: IMAGE:4959211
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTGGAATGGCTTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTTGTGGGTTTTGTTGGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers