Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274129

Xenopus ORFeome
What is the ORFeome?

ORF Name:elk3.L ORF1 Species: laevis
Gene Symbol: elk3.L Entrez Gene ID: 380571
Gene Synonyms: erp, sap2
Gene Name: ELK3, ETS transcription factor
Description: transcription factor
Plate: GDExl11019 Well: A10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824634
3' ORF Sequence: JZ829984
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ELK3, member of ETS oncogene family, mRNA (cDNA clone MGC:69011 IMAGE:4963943), complete cds
Template Accession: BC056051
GI: 33416683
Clone ID: elk3-838
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAGATCAGCATCATTATGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTTTTGGGTGTTGGATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers