Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274243

Xenopus ORFeome
What is the ORFeome?

ORF Name:emc4.L ORF1 Species: laevis
Gene Symbol: emc4.L Entrez Gene ID: 100101270
Gene Synonyms: tmem85
Gene Name: ER membrane protein complex subunit 4
Description: Predicted membrane protein
Plate: GDExl11045 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830666
3' ORF Sequence: JZ830667
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100101270, mRNA (cDNA clone MGC:81045 IMAGE:6316156), complete cds
Template Accession: BC071090
GI: 49256529
Clone ID: IMAGE:6316156
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACCCCTACAAACCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTAAGAATCCTCCTCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers