Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274759

Xenopus ORFeome
What is the ORFeome?

ORF Name:etv2.L ORF1 Species: laevis
Gene Symbol: etv2.L Entrez Gene ID: 734657
Gene Synonyms: er71, ets1, ets2-like, etsrp, etsrp71
Gene Name: ETS variant transcription factor 2
Description: Predicted transcription factor
Plate: GDExl11081 Well: F07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837080
3' ORF Sequence: JZ837079
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115679, mRNA (cDNA clone MGC:115679 IMAGE:6325017), complete cds
Template Accession: BC099054
GI: 68533971
Clone ID: IMAGE:6325017
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCCAGTATCTACTAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGAATCCTGGATCTCTGGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers