Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274765

Xenopus ORFeome
What is the ORFeome?

ORF Name:etv3.L ORF1 Species: laevis
Gene Symbol: etv3.S Entrez Gene ID: 495299
Gene Synonyms: mgc53585
Gene Name: ETS variant transcription factor 3
Description: transcription factor
Plate: GDExl11069 Well: B05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ834715
3' ORF Sequence: JZ834716
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495299, mRNA (cDNA clone MGC:81555 IMAGE:6862945), complete cds
Template Accession: BC084755
GI: 54311298
Clone ID: IMAGE:6862945
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAACTGGCTGTAGCATTGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAATCAGCAGCCACTGCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers