Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274939

Xenopus ORFeome

ORF Name:f2rl1 ORF1 Species: laevis
Gene Symbol: f2rl1.L Entrez Gene ID: 496315
Gene Synonyms: coagulation factor ii receptor-like 1
Gene Name: F2R like trypsin receptor 1
Description: 7 transmembrane receptor
Plate: GDExl11080 Well: B11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836834
3' ORF Sequence: JZ836835
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496315, mRNA (cDNA clone MGC:85172 IMAGE:6870632), complete cds
Template Accession: BC088903
GI: 57032966
Clone ID: MGC:85172 IMAGE:6870632
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGGCTGGCGGTGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGCTGCTTGTGTTGGTGTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556