Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274957

Xenopus ORFeome

ORF Name:f7 ORF1 Species: laevis
Gene Symbol: f7.S Entrez Gene ID: 444394
Gene Synonyms: coagulation factor vii
Gene Name: coagulation factor 7 (serum prothrombin conversion accelerator)
Description: Trypsin
Plate: GDExl11041 Well: B07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ827899
3' ORF Sequence: JZ827898
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC82927 protein, mRNA (cDNA clone MGC:82927 IMAGE:5514087), complete cds
Template Accession: BC073613
GI: 49115872
Clone ID: MGC:82927 IMAGE:5514087
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCCAGGGAACAAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCAAGTGTGTGCTCATCCATGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556