Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274963

Xenopus ORFeome

ORF Name:f8a1 ORF1 Species: laevis
Gene Symbol: f8a1.L Entrez Gene ID: 779431
Gene Synonyms: dxs522e, f8a, hap40
Gene Name: coagulation factor VIII
Description: protein coding, function unknown
Plate: GDExl11091 Well: C09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ838765
3' ORF Sequence: JZ838764
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis coagulation factor VIII-associated protein, mRNA (cDNA clone MGC:154554 IMAGE:8321985), complete cds
Template Accession: BC125991
GI: 116487665
Clone ID: MGC:154554 IMAGE:8321985
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACAGATGGGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGCCTTGACCTGATGGGCAAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556