Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274969

Xenopus ORFeome

ORF Name:faah.1 ORF1 Species: laevis
Gene Symbol: faah.1.S Entrez Gene ID: 100036968
Gene Synonyms: faah-1, oleamide hydrolase 1
Gene Name: fatty acid amide hydrolase, gene 1
Description: amidase
Plate: GDExl11092 Well: A08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ838926
3' ORF Sequence: JZ838925
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100036968, mRNA (cDNA clone MGC:160421 IMAGE:8549491), complete cds
Template Accession: BC129732
GI: 120538312
Clone ID: MGC:160421 IMAGE:8549491
Tissue: thymus
Stage:
Clone Library: NICHD_XGC_thy
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTTTAAAGGCACTTTTGCCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGTTTAATTTTCCACGAGTTAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556