Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274975

Xenopus ORFeome

ORF Name:fabp2 ORF1 Species: laevis
Gene Symbol: fabp2.S Entrez Gene ID: 496229
Gene Synonyms: fabp2-a, fabp2-a, fabp2-b, ifabp
Gene Name: fatty acid binding protein 2
Description: fatty acid uptake, transport, and metabolism
Plate: GDExl11061 Well: A05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833244
3' ORF Sequence: JZ833245
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496229, mRNA (cDNA clone MGC:99179 IMAGE:7206994), complete cds
Template Accession: BC088691
GI: 56788938
Clone ID: MGC:99179 IMAGE:7206994
Tissue: testis
Stage: frog
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGATGGAACAGATCTCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCTCTCTTGAAAATCCTTTTAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556