Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17274993

Xenopus ORFeome
What is the ORFeome?

ORF Name:fabp7.L ORF1 Species: laevis
Gene Symbol: fabp7.L Entrez Gene ID: 496060
Gene Synonyms: blbp, brain lipid binding protein
Gene Name: fatty acid binding protein 7, brain
Description: Fatty acid-binding protein FABP
Plate: GDExl11061 Well: D01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833329
3' ORF Sequence: JZ833330
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496060, mRNA (cDNA clone MGC:99304 IMAGE:7201992), complete cds
Template Accession: BC087470
GI: 56269213
Clone ID: IMAGE:7201992
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAGATGCCTTTTGTGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCTTCTCATACTGACGAAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers