Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17275209

Xenopus ORFeome
What is the ORFeome?

ORF Name:fam185a.L ORF1 Species: laevis
Gene Symbol: fam185a.L Entrez Gene ID: 735125
Gene Synonyms:
Gene Name: family with sequence similarity 185 member A
Description:
Plate: GDExl11080 Well: B08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836974
3' ORF Sequence: JZ836973
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115537, mRNA (cDNA clone MGC:115537 IMAGE:3377408), complete cds
Template Accession: BC097817
GI: 66911580
Clone ID: IMAGE:3377408
Tissue: egg
Stage:
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTCGTTGGTATACCGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCACACAGCCTTGCAATGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556