Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17275425

Xenopus ORFeome
What is the ORFeome?

ORF Name:eef2kmt.L ORF1 Species: laevis
Gene Symbol: eef2kmt.L Entrez Gene ID: 735173
Gene Synonyms: sb153
Gene Name: eukaryotic elongation factor 2 lysine methyltransferase
Description: Predicted methyltransferase
Plate: GDExl11064 Well: D03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833945
3' ORF Sequence: JZ833946
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC130931, mRNA (cDNA clone MGC:130931 IMAGE:7393587), complete cds
Template Accession: BC106370
GI: 76780135
Clone ID: IMAGE:7393587
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCCTGAGCCGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTTTAAGCATACATTCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers