Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17275761

Xenopus ORFeome
What is the ORFeome?

ORF Name:fes.S ORF1 Species: laevis
Gene Symbol: fes.S Entrez Gene ID: 444292
Gene Synonyms: c-fes, fps
Gene Name: FES proto-oncogene, tyrosine kinase
Description:
Plate: GDExl11041 Well: F09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828032
3' ORF Sequence: JZ828033
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80946 protein, mRNA (cDNA clone MGC:80946 IMAGE:5516233), complete cds
Template Accession: BC073445
GI: 49116710
Clone ID: fes-869
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTTTGCGGAAGAGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGGTATCTCTTGCGGATGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556