Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17275815

Xenopus ORFeome
What is the ORFeome?

ORF Name:fgfr1.L ORF1 Species: laevis
Gene Symbol: fgfr1.L Entrez Gene ID: 399444
Gene Synonyms: bfgfr, cek, fgfr-1, fgfr1-a, fgfr1-b, flg, flt-2, flt2, flt2, kal2, ogd, x1fgfr, xfgfr-1, xfgfr1
Gene Name: fibroblast growth factor receptor 1
Description: receptor tyrosine kinase
Plate: GDExl11054 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831958
3' ORF Sequence: JZ831959
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis fibroblast growth factor receptor, mRNA (cDNA clone MGC:83463 IMAGE:6861854), complete cds
Template Accession: BC077548
GI: 50603805
Clone ID: IMAGE:6861854
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCTCCGGAAGGTCCCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGTTTTTTTAGTCCACCATTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556