Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17275839

Xenopus ORFeome
What is the ORFeome?

ORF Name:fgfr4.L ORF1 Species: laevis
Gene Symbol: fgfr4.L Entrez Gene ID: 397701
Gene Synonyms: fgf receptor 4, fgfr-4, fgfr4-a, fgfr4-b, xfgfr-4, xfgfr-4a, xfgfr4
Gene Name: fibroblast growth factor receptor 4
Description: receptor tyrosine kinase
Plate: GDExl11033 Well: H06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826452
3' ORF Sequence: JZ826451
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis FGF receptor 4a, mRNA (cDNA clone MGC:79930 IMAGE:4957007), complete cds
Template Accession: BC077761
GI: 50414686
Clone ID: IMAGE:4957007
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGAACTTTGCCAGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTCCCAAGGTGAGTGTGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556