Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276163

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxd1.L ORF1 Species: laevis
Gene Symbol: foxd1.L Entrez Gene ID: 373583
Gene Synonyms: bf-2, mgc89744, xbf-2, xbf2, xenopus brain factor 2
Gene Name: forkhead box D1
Description: forkhead domain transcription factor
Plate: GDExl11087 Well: F01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838000
3' ORF Sequence: JZ837999
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis forkhead box D1, mRNA (cDNA clone MGC:131072 IMAGE:7981571), complete cds
Template Accession: BC108577
GI: 80477636
Clone ID: IMAGE:7981571
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGAGCTCTGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTTTGTAAGCACCGTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556