Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276175

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxd3.S ORF1 Species: laevis
Gene Symbol: foxd3.S Entrez Gene ID: 373610
Gene Synonyms: fkh6, foxd3-a, foxd3-b, xfd-6, xfoxd3
Gene Name: forkhead box D3
Description: forkhead domain transcription factor
Plate: GDExl11037 Well: H10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827238
3' ORF Sequence: JZ827239
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis winged helix transcription factor, mRNA (cDNA clone MGC:79918 IMAGE:5156275), complete cds
Template Accession: BC072772
GI: 49257270
Clone ID: IMAGE:5156275
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCCTGTCAAGCAGCGGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGCGCTGGCCATTTGGCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556