Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276205

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxi4.2.S ORF1 Species: laevis
Gene Symbol: foxi4.2.S Entrez Gene ID: 397954
Gene Synonyms: foxi1a, foxi4.2-a, foxi4.2-b, foxia, xfd2, xfoxi1, xfoxi1a, xlfox1a
Gene Name: forkhead box I4, gene 2
Description: forkhead domain transcription factor
Plate: GDExl11047 Well: G10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831178
3' ORF Sequence: JZ831179
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis fork head protein, mRNA (cDNA clone MGC:83274 IMAGE:6862729), complete cds
Template Accession: BC080044
GI: 51258369
Clone ID: IMAGE:6862729
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACTTTATTGTGACAACTTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACCTTCCCTGGTACAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556