Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276541

Xenopus ORFeome

ORF Name:gabarapl1 ORF1 Species: laevis
Gene Symbol: gabarapl1.L Entrez Gene ID: 443979
Gene Synonyms: apg8l, atg8, atg8l, gec1
Gene Name: GABA(A) receptor-associated protein like 1
Description: Microtubule-associated anchor protein involved in autophagy and membrane trafficking
Plate: GDExl11037 Well: E07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ827166
3' ORF Sequence: JZ827165
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80393 protein, mRNA (cDNA clone MGC:80393 IMAGE:5129997), complete cds
Template Accession: BC072921
GI: 49115105
Clone ID: MGC:80393 IMAGE:5129997
Tissue: liver
Stage: frog
Clone Library: NICHD_XGC_Li1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATTCCAGTATAAGGAGGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCCATACACGCTCTCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556