Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276577

Xenopus ORFeome
What is the ORFeome?

ORF Name:gadd45a.S ORF1 Species: laevis
Gene Symbol: gadd45a.S Entrez Gene ID: 379224
Gene Synonyms: gadd
Gene Name: growth arrest and DNA damage inducible alpha
Description: 40S ribosomal protein S12
Plate: GDExl11016 Well: H11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824359
3' ORF Sequence: JZ829718
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to growth arrest and DNA-damage-inducible, alpha, mRNA (cDNA clone MGC:53491 IMAGE:5572415), complete cds
Template Accession: BC044046
GI: 27694852
Clone ID: IMAGE:5572415
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGGAGGAGCAGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGCTCTGGCAGGTTAAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers