Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17276589

Xenopus ORFeome
What is the ORFeome?

ORF Name:gal3st4.S ORF1 Species: laevis
Gene Symbol: gal3st4.5.S Entrez Gene ID: 379295
Gene Synonyms: gal3st4
Gene Name: galactose-3-O-sulfotransferase 4, gene 5
Description:
Plate: GDExl11016 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824277
3' ORF Sequence: JZ829608
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: unknown
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to beta-galactose-3-O-sulfotransferase, 4, mRNA (cDNA clone MGC:54029 IMAGE:5571641), complete cds
Template Accession: BC045120
GI: 28175611
Clone ID: IMAGE:5571641
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTTACTTCAGCTCTGCCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTTTAGAAGCTTTCCTGATG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556